Products
myCRISPR™ – Highly Customizable DNA & RNA

CRISPR-mediated genome editing is a rapidly expanding technology that requires adaptability and reliability.

Expertise in DNA and RNA synthesis from Arbor Biosciences can help make your next CRISPR project run smoothly. Our unique, cutting-edge oligonucleotide synthesis technology combined with our rapid DNA assembly process allows for production of high-quality, low-cost DNA with fast turnaround times. Every DNA product delivered is fully sequenced by next-generation sequencing and all sgRNAs are transcribed from error-free templates.

We manufacture custom, error-free DNA templates for in vivo or in vitro transcription of sgRNA for virtually any design, delivered in a sequence verified plasmid. All sgRNA products are intended to work with Streptococcus pyogenes Cas9 nuclease. Select from plasmid, transcribed sgRNA, or homology-directed repair (HDR) templates for pairing with the intended genome editing method. HDR templates are supplied as plasmids or long single-stranded DNA.

Each product is fully customizable to work in a system of your choice, whether editing mammalian, yeast, or plant cells. Cut with confidence using proven, money-saving myCRISPR™ DNA and RNA products.

Additionally, CRISPR guide RNA libraries are provided through the myLib product line, the most cost-effective solution for creating large, high-quality libraries.

Features & Benefits

High Fidelity
Increased confidence in experimental set-up
Rapid Turnaround
Generate results quickly by reducing in-house processing time
Unlimited Targets
Single gene targeting to genome wide analysis
Efficient HDR
Deliver more frequent insertions of larger DNA sequences
Highly Flexible
Compatible with any genome screening tool
Affordable
Cost-effective tools for projects of all sizes

myCRISPR Ordering

For sgRNA sequences, please send DNA sequences for the 18-20 nt guide RNA sequence. 18-20 nt is our recommended size though other sizes can also be synthesized. For plasmids or HDR sequences, please send the full DNA sequence desired to be synthesized in 5’ to 3’ orientation. Sequence submission forms are divided into small, 1-9 products, and large, ≥10 products. Orders of 24 or more samples will be delivered in a 96-well plate, under 24 samples will be delivered in tubes unless requested otherwise. Send all sequence submission forms to: sales@arborbiosci.com. Once submitted and approved, we will generate and send a quote for placing an order.

sgRNA and pT7sgRNA

myCRISPR sgRNA is supplied as highly purified RNA transcribed from error-free plasmid DNA made using our proprietary myDNA technology. Alternatively, we supply the error-free plasmid DNA itself containing a guide RNA sequence of your choice. In both formats, the sgRNA consists of a 5’ guide RNA sequence linked to a 3’ trans-activating CRISPR RNA (tracr) sequence that binds the Streptococcus pyogenes Cas9 nuclease. Each sgRNA contains a variable sequence of a customer defined length, 18-20 nt is recommended, and an optimized tracrRNA sequence that offers improved stability and cutting (Dang et al., Genome Biology 2015). myCRISPR sgRNA and DNA plasmid templates are delivered dry unless requested otherwise. Note that T7 transcription will add two Gs to the 5’ end of your guide RNA, unless it is designed to start with one G as part of the guide sequence. Two additional Gs at the 5’ end of the guide sequence have not been shown to affect activity (Mali et al. Nat. Biotech. 2014 and Romanienko et al. PLOS One 2016). Optionally, request a custom guide RNA sequence for binding to other nucleases, such as Cpf1, to suit a particular application.

pU6sgRNA-GFP and pU6sgRNA-GFP-Puro

Both plasmids contain a human U6 promoter for expression of your sgRNA in human or mouse cells and a CMV promoter driving GFP or GFP and puromycin expression for cell sorting and selection. The guide RNA sequence and tracrRNA sequence are designed as above for the T7 transcribed sgRNA. Each plasmid can be designed to express multiple sgRNAs by the insertion of multiple U6-sgRNA cassettes. Plasmids can be transfected with Cas9 protein/mRNA/plasmid or for transfection of a Cas9-expressing cell line. Promoters other than CMV are also available upon request. Please contact us for any modifications desired for these plasmids or to generate a completely custom sequence.

High fidelity long ssDNA and error-free plasmid templates for homology-directed repair (HDR)

We recommend long ssDNA for repair with shorter DNA sequences of 200-2000 bases and plasmids for insertion of even larger sequences up to 10 kbp in size. Submission of a DNA donor sequence, including homology arms, results in delivery of a custom DNA sequence specific for each project. Each DNA is delivered dried down and is strictly quality controlled to be RNase and DNase free and fully compatible with our other myCRISPR products. Please see the myDNA product page for a more detailed description of our synthesis capabilities.


We do not recommend any particular design tools but here is a non-exhaustive list of available tools:

Be sure the targeted sequence is followed by a PAM site of NGG and that it does not include the PAM sequence in your guide RNA.


Depending on the application, we recommend obtaining the S. pyogenes Cas9 nuclease from NEB (Cat. No. M0641 for NLS containing Cas9), the mRNA from TriLink Biotech or for a plasmid based expression vector use Addgene or another preferred provider. Be sure the promoter for Cas9 expression works in the cell line being investigated. Plasmids for in vitro Cas9 mRNA synthesis can also be used, just be sure it is for the S. pyogenes Cas9 containing at least one nuclear localization sequence (NLS), unless another endonuclease is being used.

We use an optimized tracrRNA sequence of 5″GUUUCAGAGCUAUGCUGGAAACAGCAUAGCAAGUUGAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU3′. See https://www.ncbi.nlm.nih.gov/pubmed/26671237 and https://www.ncbi.nlm.nih.gov/pubmed/24360272 for a demonstration of this improved tracrRNA sequence across multiple applications. We can synthesize different tracr sequence as desired.

If your guide sequence already starts with one or more G residues, please follow these rules:

1) for T7 transcription, two Gs will be added to the 5’ end of the submitted guide RNA sequence, so if the sequence starts with a G (or two), leave them out of the submitted sequence since at least one G will be added during transcription.

2) For U6 promoter plasmids, only one G is added to the 5’ end of the guide sequence during transcription, so if the guide sequence starts with G at the 5’ end, leave that first G out of the submitted sequence.


For testing in vitro, several companies, such as ThermoFisher, NEB, or PNA Bio, offer a Cas9 nuclease that can be used with an sgRNA to rapidly test cutting efficacy of the target DNA sequence, usually a PCR product from genomic DNA. This in vitro test is no guarantee the sgRNA will work in vivo, but if the in vitro reaction fails, it might be best to redesign your targeting sequence or analyze RNA quality if doing in-house transcriptions. To analyze cutting efficiency and off-target effects in cells, a T7 endonuclease I assay, such as NEB kit E3321S, is the fastest way to detect indels that result from cutting of the DNA target, but it is not the most sensitive. TIDE is an NGS-based approach, which involves sequencing PCR products made from primers that flank the cut site. More info on TIDE is here: https://tide-calculator.nki.nl/.

For a small additional fee, we will treat your sgRNA with phosphatase to remove the 5’ triphosphate which can activate innate immune effector proteins in some cell types.

Ordering Information

Catalog # Description Quantity Price Contact Us
801001 sgRNA: sgRNA only 1 nmol $199 Order Now
801005 sgRNA: sgRNA only 5 nmol $399 Order Now
802001 pT7sgRNA: T7 promoter plasmid with sgRNA sequence 1 ug $99 Order Now
803001 pU6sgRNA-GFP: U6 promoter plasmid with sgRNA and GFP 1 ug $99 Order Now
803101 pU6sgRNA-GFP-Puro: U6 promoter plasmid with sgRNA, GFP and Puromycin 1 ug $99 Order Now
804001 Long ssDNA: HDR template 200-2000 bases 3 ug $0.85/base Order Now
Inquire Homology-Directed Repair Plasmids: Custom error-free DNA 1 ug Variable* Order Now