Resources
FAQs

myArrays are synthesized on standard sized glass substrates (~26mm x ~75mm x ~1mm). Any equipment (fluidics stations, hybridization stations, scanners, centrifuges, etc.) developed to use standard “microscope” slide-sized substrates should accommodate myArray slides.

No. myArrays are made by synthesizing single stranded oliogonucleotides directly on glass substrates.

Yes, myArrays can be used with Agilent Technologies’ gasket slides and hybridization cassettes. Agilent hybridization cassettes are compatible with all myArray formats. Which Agilent gasket slide is used depends on the myArray format. Six by 5K (or 7K) myArrays use Agilent’s 8-gasket backing slide. Three by 15K (or 20K) myArrays use Agilent’s 4-gasket backing slide. Thirty or 40K myArrays use Agilent’s 2-gasket backing slide. All other formats (60, 80K) use a one gasket backing slide.

No. Agilent Technologies’ hybridization cassettes and backing slides can be found here. If you would prefer other options, please contact techsupport@arborbiosci.com.

Yes, myArrays can be scanned with an Agilent scanner. However, gal (GenePix alignment) files we provide cannot be used for data extraction. Gal files can be converted to the appropriate Agilent scanner compatible file type but Arbor Biosciences does not support this process. We recommend the Axon 4000 series of scanners.

In addition to your myArray slides, you will receive a spike-in control oligo mixture and, by email, a gal (GenePix alignment) file that describes the location and probe information for each feature. Control oligos may be added to hybridization solution (1l control oligo per 100l of hybridization solution). These fluorescent oligos will bind to control probes on each myArray. Control probes may be omitted upon customer request. Signal from the control probes may help determine if the hybridization and washing stringency were sufficient and aid in proper data extraction grid alignment.

myArray probes can be any length the customer desires. However, Arbor Biosciences recommends probes no longer than 50mers. Catalog myArrays have probe lengths of 45-47 bases (the slight variation in probe length insures that all probes fall within a narrow Tm distribution). One myArray may contain probes of different length. Custom probe lengths longer than 50mers are possible (please inquire). Due to the step-wise yield during synthesis (98-99%), it is not advisable or practical to manufacture probes longer than 60mers as the final yield will deteriorate rapidly with longer probes.

We synthesize probes 3′ > 5′. This orientation will covalently tether the 3′ end of the probe to a spacer molecule and the 5′ end of the probe will be free.

No. All probes on myArrays are not cleavable (removable).

All probes are synthesized on amine-functionalized glass substrates 3′ > 5′. Probes are covalently attached to the glass substrate as follows: glass-amine-spacer-probe. Probe sequence is pushed away from the substrate surface by first synthesizing a lawn of poly deoxy Thymidine spacer everywhere. The spacer prevents steric hindrance during binding experiments. The default spacer is 15 nucleotides in length. Spacers of different length or composition are available, please inquire.

We use glass substrates that have a notch in one corner  for unambiguous orientation. With the notch in the upper right hand corner, as shown in Figure 1, the surface containing probes is facing you. Additionally, the sticky label with bar code will be on the surface that has the probes.

Currently, 80K features per array.

Up to 6 for our standard 5K and 7K formats.

Custom formats are also available. Your custom design, however, must fit within the potential synthesis area.

Catalog arrays have at least three technical replicates of each unique probe sequence within each myArray.  Some catalog arrays are available with 5 or more replicates. For custom designs, the extent of probe replication is up to the customer. Different replication levels for different sets of probes can be included on one myArray.

 

Custom myArrays

Because our proprietary synthesis is flexible, often we can synthesize arrays that satisfy customer specifications without increased cost. However, we cannot synthesize features outside of the potential synthesis area (see Figure 1) and the maximum number of features we can synthesize on one slide remains 80K.

We cannot synthesize on plastic. We may be able to synthesize on glass or silicate substrates provided by our customers as long as the substrate dimensions are a standard size (~1mm x ~26mm x ~76mm). In cases where a type of substrate surface modification has not been tested in our system, we recommend a small, low cost, pilot study to determine if oligonucleotide synthesis is possible (based on our QC process) and if your custom myArray functions well in your process.

Our default spot size is ~60mm in diameter. Currently we cannot synthesize spots smaller than the default size. However, we can synthesize features that have a larger surface area compared to the default surface area (~3000mm2).   Larger spot sizes will be rectangular. Please contact our technical staff for details.

 

Probe Design

Probes for gene expression myArrays are designed using a proprietary version of publically available software called OligoArray2.1 (see here). Probe sequences for our catalog arrays are deposited in OligoArrayDb (see here

Yes. If your organism of interest is not listed on our website, we can design probes for you if the genome has been completely sequenced, fully annotated and publicly available.

Typically our standard probe design is complementary. Our standard design attempts to design up to three specific probes per gene. We will likely not be successful for all genes (e.g., some genes will have only 2, 1 or no specific probes). For genes with no specific probes, we may be able to design a probe or probes that are predicted to cross hybridize to other genes. If we include these potentially cross-hybridizing probes on the array (this is up to the customer), we will disclose all “other” genes that may cross hybridize to the probe. Customers may choose the number of specific probes per gene to include on the array (up to 3) and the number of technical replicates per unique probe sequence (minimal recommendation is 3).

Yes. Probe sequences are submitted as either a tab delimited text file or an Excel file. Only two columns are necessary; an ID column and a sequence column. Please submit only one instance of each unique probe sequence no matter how many technical replicates you may desire within each array. A third column, replication number, is only necessary if different replication is desired for subsets of probes. Please submit sequences in the standard 5′ > 3′ format. We cannot synthesize degenerate bases (e.g., R, Y, M, K, S, N, etc.), so please submit only A, C, G or T. You may submit probes of any length up to 50 bases.

 

Ordering

Most often customers will request a quote by either contacting sales@ArborBiosciences.com or our microarray product manager, Donald Schwartz, Ph.D. (drs@ArborBiosciences.com). Along with the quote, we will send an order form. To initiate the order, either fill-in and return the order form by email, or have your institution send a PO by email or fax (734)-998-0750.

Yes, there are discounts for ordering larger quantities of slides. Currently, there is a 5% discount for ordering 20-49 slides and a 10% discount for ordering 50 or more slides.

Most orders are shipped within two weeks of receipt of the order form or PO but it may take up to 4 weeks.

 

Storage

myArrays are vacuum sealed in a plastic bag inside a plastic slide holder. myArrays are very stabile in the original packaging, assuming the vacuum seal has not been compromised, when stored at the room temperature (~22C) away from moisture and light. Please do not freeze or refrigerate myArrays at any time. Once the slide mailer has been opened, unused slides are best stored in the same mailer and, if possible, stored under vacuum.

 If stored properly, myArrays should be stabile for at least 6 months.

 

Hybridization

Hybridization temperature depends on a number of variables. Arbor Biosciences technical staff will be able to recommend an initial temperature for your application.

myArrays are compatible with lifter slips for static hybridizations (incased in a hybridization cassette and immersed in a water bath) and Agilent Technologies gasket slides for dynamic hybridizations (in hybridization ovens using Agilent Technologies hybridization cassettes and backing slides). Typically, >20hrs is recommended for static hybridizations and minimally 12hrs is recommended for dynamic hybridizations. These suggestions assume a fluorescent target concentration of ~35ng/uL, mean length of ~150nt and specific activity of ~1fluor moiety per 30 bases.

Yes. We will provide a recommended target preparation and hybridization protocol (for converting total RNA to fluor-coupled amino-allyl-cRNA). The protocol will have a recipe for the hybridization solution.

 

Washing and Scanning

myArrays are synthesized on 26mm x 75mm glass substrates. Any washing/hybridization station that accommodates this format should work. However, it is not necessary to have expensive equipment to wash myArrays. Standard 50ml centrifuge tubes can be used, but these can be a bit awkward to use and throughput is poor. Alternatively, standard microscope washing/staining dishes with metal or glass racks can be used. We prefer the later because it is an inexpensive solution, the dishes are readily available from numerous scientific supply houses that sell histology supplies and, with a standard stir plate and stir bar, wash solutions can be agitated to facilitate washing.

No. myArrays are synthesized on 26mm x 75mm glass substrates. Any scanner designed to accommodate ~1×3 inch microscope slides should work well. For example, myArrays have been scanned with the GenePix® 4000B and 4000A (Molecular Devices, Sunnyvale, CA), Agilent, and Innoscan scanners.

Of course the fluorescent intensity of your target as well as the amount of target hybridized impacts the PMT setting. Most scanners will have an option to auto set the PMT, which may or may not work well. We recommend actively adjusting the PMT during scanning so that the full dynamic range of signal is achieved. The PMT should be set such that only a few features (1-2%) have some pixels (<10%) that are saturated. Under these conditions, the full dynamic range of signal intensity is appreciated.

myArray standard feature diameter is ~60µm. We suggest scanning at 5µm per pixel resolution.


Bait design assistance: dividing sequences into probes & removing non-specific baits (if you wish)
Biotinylated RNA baits according to your custom design
Hybridization reagents

You will receive enough probes & reagents for performing the stated number of individual capture reactions of your kit size (e.g., 16 reactions) according to our current protocol. Please note that there are some additional reagents & equipment you will need to supply in order to perform a MYbaits capture. Please review the list of required materials in the Manual to make sure you have everything you need before using your kit.

If you are looking for prices for in-house laboratory services (library preparation, target capture, & NGS sequencing), please visit our myReads page for more information.


Please gather your target sequences in FASTA format or as genomic coordinates according to our guidelines, and contact us with the details of your project to obtain a Quote. Please let us know upfront if there is a specific kit size in which your design should be constrained (e.g. a myBaits-3 kit with up to 60,000 probes) so that together we can adjust your bait design accordingly. Otherwise, we can let you know the estimated price of your design after processing your sequences.

In this context, we use the terms interchangeably. Some fields prefer one term over the other, so we use both terms.

myBaits kits are compatible with almost all major NGS library preparation kits on the market for most major types of sequencing platforms, such as Illumina®, Ion Torrent®, and Roche 454®. Contact us to ask about how to perform myBaits capture with other types of NGS platforms (e.g. PacBio®, Oxford Nanopore®).

If you are using a never-before-tried library prep protocol with your myBaits kit (especially if you are new to NGS), we strongly recommend that you first perform some total library (shotgun) sequencing before doing myBaits enrichment. This is important in order to verify that your chosen library prep kit generates libraries of sufficient complexity and minimal bias in your hands, otherwise you will experience poor target capture results. High quality libraries are absolutely essential for achieving a successful target capture project.

Provided below are links to companies that sell NGS library prep kits that are known to be compatible with myBaits. This is NOT an exhaustive list; there are many other unlisted kits that are also compatible with myBaits. Also, kits on this list may not necessarily be appropriate for your samples. NGS library prep is not “one size fits all”; different factors such as sample type, DNA input amount, genome complexity, and sequence composition may influence the type of library prep kit that would be best for your application. For example, low input, degraded, and/or damaged DNA templates may require special handling (see below) and/or modifications to commercial kits.

Contact these and other manufacturers to learn about your options and find what works best for your samples and project needs:

  • Illumina
  • New England Biolabs
  • Kapa Biosystems
  • Bioo Scientific
  • Rubicon Genomics
  • Swift Biosciences

 

Modified protocols for lower-cost library preps:

  • TC Glenn et al. 2016. “Adapterama I: Universal stubs and primers for thousands of dual-indexed Illumina libraries (iTru & iNext)”. bioRxiv, http://dx.doi.org/10.1101/049114
  • N Rohland, D Reich. 2012. “Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture”. Genome Research, doi: 10.1101/gr.128124.111
  • Recommended especially for degraded/ancient DNA (blunt-ended library prep):
    • M Meyer, M Kircher. 2010. “Illumina Sequencing Library Preparation for Highly Multiplexed Target Capture and Sequencing”. Cold Spring Harbor Protocols, doi:10.1101/pdb.prot5448
    • M Kircher, S Sawyer, M Meyer. 2012. “Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.” Nucleic Acids Research 40(1): e3, doi: 10.1093/nar/gkr771


One important component of your myBaits kit are the adapter-specific blocking oligos (reagent “Block#3”). The type of Block#3 that is provided to you varies depending on the specific adapter and indexing structure of NGS library that you are using (e.g. Illumina TruSeq-style libraries with dual 8bp barcodes vs. single 6bp barcodes vs. Nextera-style with dual 8bp barcodes). In order for us to provide the correct Block#3 option(s), it is critical that you accurately report which NGS library preparation system you plan to use with your myBaits kits. If you are not certain, or later decide to change your library prep kit, please contact us ASAP so we can instruct you on how to obtain the correct blocking oligos.

We do not offer any guarantees for downstream sequencing performance. This is because it is not possible to predict the actual sequencing behavior of new baitsets (including parameters such as on-target percentage, unique read depth, and evenness of coverage) without experimental test data, and knowledge of your experimental parameters. Factors such as the overall size and GC content of the bait sequences, the sequence divergence between baits & targets, the quality of your NGS libraries, and the sequencing depth that you use will have a major impact on your post-enrichment outcomes.

In practice, myBaits kits have frequently achieved high on-target percentages. But the outcome of your experiment will be necessarily dependent on the properties of the baitset, your samples, and your chosen experimental conditions.
The best practice for optimizing new target capture designs is to perform a pilot test to determine the behavior of the baitset under your chosen conditions and with your samples, and adjust parameters such as sequencing depth, hybridization stringency, or number of capture rounds accordingly. For example, to maximize your on-target percentage, you could consider making upfront protocol adjustments such as performing two consecutive rounds of capture, as long as you are working with sufficiently high-quality, complex libraries.


We provide most of the hybridization reagents and a specific protocol to use with the kits. Please see the latest myBaits Manual for the current protocol. Here you will find the list of materials (reagents & equipment) that you will need to supply in order to perform the captures.

Alternatively, experienced users may wish to supply their own reagents in order to use the myBaits probes in a custom hybridization protocol. Please verify that your user-supplied hybridization protocol is appropriate for biotinylated RNA probe oligos. Please be aware that we cannot offer technical support for experiments that deviate from our recommended protocol and/or supplied reagents.


Hybridization & Wash Temperature – For most applications, we recommend 65°C for hybridization, bead-bait binding, and wash temperatures. However for samples where a majority of targets are shorter than the baits (i.e., from degraded DNA sources such as aDNA specimens), we recommend ~55°C for all three steps for improved captured target complexity, or ~60°C-65°C if higher on-target percentage is the priority. However, please note that optimal temperatures WILL vary by bait set and library, and will require trials to identify.

Hybridization Time – For most applications, hybridize for 16 to 24 hours. For very rare targets (e.g., those in ancient, forensic, or environmental samples) hybridize for 24 to 40 hours. Shorter and longer times can be tolerated, though will require trials to identify optimal performance. Ensure that the chosen combination of tubes and thermal cycler allows no more than 15% volume evaporation over the chosen time and temperature.

One or Two Rounds of Capture – For rare targets, the improvement in specificity (raw reads mapping to your targets) may not be high enough after a single round of target capture for sufficient unique coverage at your chosen sequencing depth. For example, even a 100× enrichment rate will only increase the specificity of a 0.1% pre-enrichment target (for example, 1K target reads among 1M total shotgun reads) to 10% post-enrichment. In such cases, performing two consecutive rounds of target capture might be the most efficient route to boost your sequencing specificity. However, there will always be a loss in sensitivity (unique read complexity) following a second round of capture; depending on your starting complexity, this sensitivity loss may or may not be tolerable in your experimental design.


Yes! Our expert myReads team provides a range of in-house NGS services for custom projects, including library preparation, target capture with myBaits, and high-throughput sequencing. Visit the myReads product page to learn more about our service options and pricing.

We are pleased to provide as much bait design advice and assistance as possible. However we are unlikely to be sufficiently knowledgeable in your particular field as to help you pick the specific genes/targets for your project. Whether this is your first NGS project and/or you are an experienced genetics researcher, we always recommend that you choose your targets in collaboration with your full research team, especially your bioinformatician(s), so that your kit design is as robust as possible.

Some general suggestions appropriate for many projects would be to exhaustively survey the literature for your organism(s), and consider including neutral and/or control loci in addition to specific targets of interest. You should include enough loci and/or SNPs to draw significant conclusions within the number of specimens that you plan to survey. You should make sure that you have thoroughly evaluated your bait design before proceeding with your kit order.

If you are beginning a completely new project, you may wish to order the smallest number of reactions upfront, and place a re-order for a larger number of reactions once you have tested the design. However just note that any changes (add/drop baits) to your design would need to be manufactured as a new custom kit, which has longer delivery times than a reorder of a previous design.


Please gather your target sequences in FASTA format or as genomic coordinates according to our guidelines, and contact us with the details of your project to obtain a Quote. Please let us know upfront if there is a specific kit size in which your design should be constrained (e.g. a myBaits-3 kit with up to 60,000 probes) so that together we can adjust your bait design accordingly. Otherwise, we can let you know the estimated price of your design after processing your sequences.

The bait manufacture turnaround time varies depending on the specific baitset and the number of other kits in our queue, but it is typically ~8 weeks minimum for your baits to pass our QC process. Our turnaround time is necessary so that we can carefully manufacture your custom probes according to our high-quality standards. Please do NOT wait until the last minute to place your order, as we cannot rush orders. We are continually working to reduce manufacturing turnaround times.

Also, please consider that if you choose to utilize our complementary bait design services, we will typically be in correspondence for an additional upfront period (up to several weeks) regarding a design before we can proceed to the bait manufacturing (see above). This can be skipped if you provide us with pre-designed probes that do not require any additional design work. Please remember to accommodate additional time for your collaborators to approve the final design.


Capturing individual libraries produces the best per-sample results. However, multiple dual-indexed libraries can be pooled into single capture reactions (e.g. “multiplexing”) in order to assay more samples with a smaller kit. For new baitsets, we strongly recommend first performing trial captures with different pooling schemes to determine what works best for your particular samples and bait set. When pooling libraries that vary in relative target content (e.g., ancient, forensic, or environmental samples), try to equilibrate by observed or expected target molarity, rather than by total library molarity.

We generally do NOT recommend pooling multiple samples per capture reaction for very degraded and/or rare targets (e.g. ancient DNA), or for very large targets (e.g. a WGE baitset targeting an entire genome). When working with ancient DNA specimens and small targets (e.g. mitochondrial DNA), consider diluting your probes and performing separate captures, rather than pooling multiple samples into a single capture reaction.


Target capture necessarily requires subjecting your libraries to a bottleneck, wherein target molecules are captured and therefore enriched, and non-target molecules are therefore removed. To have sufficient unique molecules for good sequencing coverage of your targets, successful captures DEPEND on the input of sufficiently complex libraries. For this reason, we recommend an input DNA amount of 100-500ng into each capture reaction, as amounts in this range typically perform very well. However MYbaits can be used with as few as 1 ng and as many as 2 µg of library. For libraries with a significant non-target component (e.g., ancient, forensic, or environmental samples), maximize the target component in each capture by using as much library as possible up to 2 µg, and consider two rounds of capture for higher percentage of reads on-target.

For best results, it is recommended that only amplified (non-PCR-free) NGS libraries are used for target capture. This provides multiple copies of each starting template molecule, increasing the chance of each individual molecule getting enriched. However if you need more starting material to reach the recommended amount, it is generally preferable to generate more library from fresh genomic DNA or a new batch of indexed library, rather than through extra amplification. This is because while some amplification is good, over-amplification risks reducing the observable complexity of your libraries through the uneven action of PCR bias, as some molecules will become relatively more abundant while others become rare. This is also true for manipulating your libraries after capture: amplify your post-capture libraries the minimum number of cycles necessary to reach the molarity required by your sequencing facility.


We cannot synthesize mixed bases, only A/T/C/G bases. If there are ambiguous bases (except for “N”) in your sequences, we will replace them with a single candidate base (e.g. C or T for “Y”) before bait synthesis.

If there are “N” bases in your sequences, we will skip over these ambiguities by default when we design baits. If you do not want this, you should replace them with putative sequence according to your best knowledge — for example, fill in those positions with “best guess” sequence from another allelic or species variant, if possible. If this is not possible, then you can instruct us to replace them with a filler base (T) prior to bait design. Using filler bases is appropriate for singleton or a couple of Ns, however long stretches of unknown sequence should just be omitted outright because they do not make any useful contribution to your bait design.


If you are using transcriptome sequences for your bait design, you may or may not know the location of the exon boundaries. However, this is not necessarily a problem for bait design, since we will typically design overlapping baits tiled across the full sequence. Any baits spanning across exon boundaries may not work well, but they will have neighboring baits which will still function. However any short exons (below the bait length) may not be recoverable unless they can be “padded” with true genomic (intronic) sequence.

Your decision whether to include more than 1 bait variant to represent additional diversity for a given region should depend on (1) the amount of diversity you want to have the ability to capture and (2) the maximum number of unique probe sequences that you want to purchase.

The ability of a given bait to hybridize to a target sequence will necessarily be dependent on the hybridization & washing conditions that you choose. Under the standard capture conditions, it is generally expected that a bait should be able to capture sequences of at least 5-10% local nucleotide divergence. Therefore, for example, it is normally NOT considered necessary to include probes for both allelic variants of a singleton SNP in a bait design, since a single bait should be able to capture both. However if you have many SNPs within a small window, you may wish to include more than 1 representative haplotype within your baitset. Please note that we cannot synthesize ambiguities.

That being said, the specific performance outcome of YOUR custom baitset, samples, and experimental conditions cannot be directly predicted. Target capture parameters such as sequence content of your custom baitset (e.g. GC% range, secondary structure), bait-to-bait interactions, and hybridization & washing performance will all impact capture outcomes. Additional experimental factors such as library quality, amplification parameters, multiplexing level, and sequencing depth will also be of critical relevance.


Yes! As long as we receive written permission from the original designer(s) (if it is not your kit), you can re-order any past design that we have manufactured. We can usually provide such re-orders within ~2 weeks of ordering. Please no rush orders.


Any design requiring from 1 to 20,000 probes falls into our smallest “myBaits-1” tier baitset scale, therefore there is no reduced price for ordering smaller probesets. However please note that probes for all custom designs are provided at the same concentration, regardless of the number of individual baits in the design.

16 reactions is now our minimum custom kit size (for both new and repeat orders). We cannot provide discounted kits for fewer reactions.


The myBaits WGE product ONLY offers bait production directly from high quality genomic DNA precursor material, which you must physically provide to us (either extracted in your lab or purchased via a third-party gDNA supplier). We do have the ability to design and synthesize synthetic RNA bait oligo pools via our standard myBaits custom kit product, however this is NOT an option for large nuclear genomes (e.g. from plants or animals), due to prohibitively large numbers of baits that would be required. However if you are working with an organism that has a smaller genome (e.g. from bacteria), or would be interested in capturing only a portion of an entire genome, then a custom myBaits kit may be possible. Please contact us with details about your project goals and budget, so we can advise you on the best approach.

Target capture necessarily requires subjecting your libraries to a bottleneck, wherein target molecules are captured and therefore enriched, and non-target molecules are therefore removed. To have sufficient unique molecules for good sequencing coverage of your targets, successful captures DEPEND on the input of sufficiently complex libraries. For this reason, for libraries with a significant non-target component (e.g., ancient, forensic, or environmental samples), and especially for WGE captures with a very large full nuclear genome target size, we strongly recommend maximizing the target component in each capture by using as much input library as possible (up to 2 µg+), and consider two rounds of capture for higher percentage of reads on-target.

For best results, it is recommended that only amplified (non-PCR-free) NGS libraries are used for target capture. This provides multiple copies of each starting template molecule, increasing the chance of each individual molecule getting enriched. However if you need more starting material to reach the recommended amount, it is generally preferable to generate more library from fresh genomic DNA or a new batch of indexed library, rather than through extra amplification. This is because while some amplification is good, over-amplification risks reducing the observable complexity of your libraries through the uneven action of PCR bias, as some molecules will become relatively more abundant while others become rare. This is also true for manipulating your libraries after capture: amplify your post-capture libraries the minimum number of cycles necessary to reach the molarity required by your sequencing facility.


We generally do NOT recommend pooling multiple samples per capture reaction for very degraded and/or rare targets (e.g. ancient DNA), or for very large targets (e.g. a WGE baitset targeting a full nuclear genome). In fact, for highly degraded samples, you may achieve better results by performing multiple parallel WGE reactions per sample.

 


We do not recommend any particular design tools but here is a non-exhaustive list of available tools:

http://crispr.mit.edu/
http://crispr.cos.uni-heidelberg.de/
http://chopchop.cbu.uib.no/

Be sure the targeted sequence is followed by a PAM site of NGG and that it does not include the PAM sequence in your guide RNA.


Depending on the application, we recommend obtaining the S. pyogenes Cas9 nuclease from NEB (Cat. No. M0641 for NLS containing Cas9), the mRNA from TriLink Biotech or for a plasmid based expression vector use Addgene or another preferred provider. Be sure the promoter for Cas9 expression works in the cell line being investigated. Plasmids for in vitro Cas9 mRNA synthesis can also be used, just be sure it is for the S. pyogenes Cas9 containing at least one nuclear localization sequence (NLS), unless another endonuclease is being used.

We use an optimized tracrRNA sequence of
5”GUUUCAGAGCUAUGCUGGAAACAGCAUAGCAAGUUGAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU 3’. See https://www.ncbi.nlm.nih.gov/pubmed/26671237 and https://www.ncbi.nlm.nih.gov/pubmed/24360272 for a demonstration of this improved tracrRNA sequence across multiple applications. We can synthesize different tracr sequence as desired.

If your guide sequence already starts with one or more G residues, please follow these rules: 1) for T7 transcription, two Gs will be added to the 5’ end of the submitted guide RNA sequence, so if the sequence starts with a G (or two), leave them out of the submitted sequence since at least one G will be added during transcription. 2) For U6 promoter plasmids, only one G is added to the 5’ end of the guide sequence during transcription, so if the guide sequence starts with G at the 5’ end, leave that first G out of the submitted sequence.

For testing in vitro, several companies, such as ThermoFisher, NEB, or PNA Bio, offer a Cas9 nuclease that can be used with an sgRNA to rapidly test cutting efficacy of the target DNA sequence, usually a PCR product from genomic DNA. This in vitro test is no guarantee the sgRNA will work in vivo, but if the in vitro reaction fails, it might be best to redesign your targeting sequence or analyze RNA quality if doing in-house transcriptions. To analyze cutting efficiency and off-target effects in cells, a T7 endonuclease I assay, such as NEB kit E3321S, is the fastest way to detect indels that result from cutting of the DNA target, but it is not the most sensitive. TIDE is an NGS-based approach, which involves sequencing PCR products made from primers that flank the cut site. More info on TIDE is here: https://tide-calculator.nki.nl/.

For a small additional fee, we will treat your sgRNA with phosphatase to remove the 5’ triphosphate which can activate innate immune effector proteins in some cell types.

 


Our goal is to provide NGS service for your project as if you were working directly with one of your research collaborators. We strive for a transparent and cooperative approach to NGS projects, and will communicate openly with you to find the right solution for your individual research design needs. We have decades of collective experience in molecular biology, including target capture & high-throughput sequencing, and working with difficult specimens.

In order to facilitate transparent, collaborative projects, we have opted to not offer specific guarantees for target capture & sequencing service projects, since every custom project is completely unique. In science, sometimes research projects do not go 100% according to plan. However, you will only pay for the services that we actually perform. We will give every project our individual attention, and all laboratory work is performed by hand on the bench by our team of dedicated & experienced researchers. Our goal is to provide you with the very same dedicated laboratory attention that you & your research team would give to your own work. You can be assured that we will communicate openly with you about all aspects of your project, and will not commit to a project before first discussing all the options with you.


We offer a full suite of services for next-generation sequencing projects, on both regular specimens as well as degraded specimens such ancient DNA including:

Library preparation for Ion Torrent, Illumina, and PacBio
Target enrichment using myBaits catalog and custom kits
High-throughput sequencing on Ion Torrent, Illumina, and PacBio instruments


We currently do not offer DNA extraction as a standard service option. However, we do have the facilities and expertise for performing DNA extraction on both regular and degraded specimens. Therefore, we may be able to offer this for your project, depending on the circumstances. Please contact us  directly to inquire about special service options.

We offer NGS service on any type of non-hazardous DNA extract, whether from high-quality or degraded specimens. However, your samples should still meet our standard submission requirements for your type of service project, including relevant negative controls where applicable. Otherwise, your samples may be unable to pass our quality controls, or your project could be delayed. Please note that currently we are not accepting projects on human ancient DNA specimens for target capture of human DNA.

The guidelines in our Sample Submission Form should be sufficient for most standard DNA extracts derived from fresh, high-quality, relatively recent genomic DNA specimens (e.g. DNA extracted from fresh, frozen, or alcohol-preserved tissues).
In addition, we are currently accepting most service projects for atypical or sensitive samples, including specimens with degraded or rare targets (e.g., ancient DNA, museum, archival, metagenomic, environmental, etc). However, you should first contact us with more information about your samples & research goals, so that we can determine if we are able to accept your project. We may provide you with a customized set of sample submission requirements that are tailored for your particular application.

Due to the inherently variable nature of target capture & high-throughput sequencing experiments (especially for new, untested, custom baitsets), we are unable to offer service guarantees related to turnaround time, unique read sequencing coverage depth, on-target percentage, and other experimental outcomes.

In order to facilitate transparent, collaborative projects, we have opted to not offer specific guarantees for service projects, since every custom project is completely unique. In science, sometimes research projects do not go 100% according to plan, and for target capture, it is very difficult to plan for specific sequencing outcomes without prior experimental data. However, you will only pay for the services that we actually perform, and we will not accept a project before discussing all the options with you.

You will receive updates and estimated timelines for completion of different stages of your project. If you are working within a specific deadline, we will certainly make every effort to accommodate that, though we cannot guarantee that it will be possible to finish your project within that window.


We would prefer that we make the libraries so that we have direct control over the uniformity and quality of the libraries going into target capture. However, yes, you can provide us directly with libraries that you make yourself. Please confer with us to make sure that we are fully aware of the type of libraries that you are using, since it is critical to choose the correct adapter-specific blocking oligos during capture and the right amplification primers after capture.

Yes, absolutely. We typically have enough material to perform multiple different types of captures from a single set of libraries that we generate. Please contact us for more information about pricing for your individual project configuration needs.

 


Generally we recommend probe densities between 3-10 probes per kilobase for target regions larger than 50kb. For target regions between 10-50kb, probe densities should be on the higher end of that range, and we may recommend using multiple fluorophores per probe to boost the signal.

We offer complementary FISH probe design service using our proprietary design algorithm for most types of FISH projects. Please contact us with a brief description of your project, including the name of your study species, genomic coordinates, and any additional information. 
 

We can work with any sequence to design probes. Please contact us with a brief description of your project, including the name of your study species, genomic coordinates, and any additional information.

The number of assays per library depends on a number of factors including the probe density of your library, the size of your target region, the number of probes in the library, and the FISH protocol. Generally we recommend starting with 10pmol of labeled probes per standard FISH slide and then modifying the input amount based on the initial results.

Atto-550 is our most popular dye labeling option, followed by Atto-488, Atto-594, and Atto-647N. Biotin, Digoxigenin and 6FAM are also popular options that work well in multi-color FISH assays.

We may be able to accommodate other labeling options, please contact us for availability.

myTags FISH libraries are compatible with most FISH protocols. Please contact us for recommendations.

We generally ask for up to 4-6 weeks after an order is placed to ship myTags libraries.

 


Yes, we provide the myTags labeling protocol with all myTags immortal libraries for perfroming the labeling process in your own lab. If you would like to use a different protocol, one of our scientists would be happy to provide assistance to ensure success.

Generally we recommend probe densities between 3-10 probes per kilobase for target regions larger than 50kb. For target regions between 10-50kb, probe densities should be on the higher end of that range, and we may recommend using multiple fluorophores per probe to boost the signal.

We offer complementary FISH probe design service using our proprietary design algorithm for most types of FISH projects. Please contact us for design assistance

We can often accommodate customer-designed probes into the myTags labeling framework. Please contact us for recommendations on the design parameters and other information before designing your probe sequences.

Yes, we can synthesize immortal probe libraries that can be labeled using the Oligopaints labeling method. Please note these probe libraries are not compatible with the myTags labeling protocol due to sequence requirements of the Oligopaints method.

We can work with any sequenced data to design probes. Please contact us with a brief description of your project, including the name of your study species, genomic coordinates, and any additional information.

We generally supply myTags Labeled Libraries in 3-4 weeks and myTags Immortal Libraries in 2-3 weeks, after an order is placed.

 


Unfortunately, this may lead to considerably decreased performance or even loss of function. To ensure highest kit performance, make sure to store Sigma 70 Master Mix at -80 °C and freeze as soon as possible after usage.

You`re advised to keep the number of freeze-thaw-cycles to a minimum. Nevertheless, we found that up to five freeze-thaw-cycles do not negatively influence protein production efficiency of the Sigma 70 Master Mix.

Yes. The myTXTL® Sigma 70 Master Mix contains tRNAs for seven codons rarely used in E. coli to prevent undesired translation stop.

As the myTXTL® platform completely relies on the endogenous transcription and translation machinery of E. coli making use of the core RNA polymerase and the primary sigma factor 70 (σ70), all genes should be cloned downstream of a σ70-specific promoter, e.g. the promoter found in P70a vectors. For a more general advice on how to construct a functional gene cassette, please refer to the myTXTL® kit manual (LINK).

Efficient in vitro protein production is highly dependent on the quality of the template DNA, which should be free of nucleases (DNases, RNases) and inhibitors of the TXTL machinery (e.g. EDTA, ethidium bromide, SDS, Cl- ions, ethanol). Preparation of plasmid DNA with standard commercial kits usually involves sample treatment with RNase, which may not be completely removed during downstream processing. Thus, we strongly recommend subjecting the prepared DNA to either a commercial PCR clean-up kit or standard phenol-chloroform extraction and ethanol precipitation. Ideally, template DNA is suspended in nuclease-free water. 
Please note, introducing Mg2+and K+ ions can compromise the kit performance, as they are extremely critical for transcription and translation, and are optimized in the systems.

deGFP is a N- and C-terminally truncated version of the reporter eGFP that is more translatable in cell-free systems. The excitation and emission spectra as well as fluorescence properties of deGFP and eGFP are identical.

Yes. Due to the manufacturing process, there might be a small pellet visible. It`s critical that you resuspend the Sigma 70 Master Mix completely before aliquoting it to set up your TXTL reaction(s).

Yes! That only requires the addition of a plasmid coding for T7 RNA polymerase under transcriptional control of a σ70-specific promoter, e.g. P70a-T7rnap. This plasmid – along with hundreds of others – is part of a Toolbox 2.0 Plasmid Collection and can be purchased here (LINK). The optimum concentration of P70a-T7rnap is usually between 0.1 nM and 1 nM. Higher concentration normally does not increase protein yield. The more important parameter for efficient protein expression is the concentration of the plasmid that encodes for your protein of interest downstream of the T7 promoter, which will be most likely in the range of 5-20 nM.

Yes, although it`s not optimized for linear DNA templates. Considerably enhanced protein yields can be achieved by supplementing the Sigma 70 Master Mix with our nuclease inhibitor GamS (LINK).

Due to the small reaction volume of 12 μL, it is very important to avoid condensation of water on lid of the reaction tube, as it considerably increases the concentration of myTXTL® components. This can lead to an unreproducible kit performance. In general, water facilitates a faster heat transfer than air and a water bath shows low temperature fluctuation, which should – combined with a closed environment with constant temperature surrounding the entire tube – lead to higher reproducibility and yield.

Component inactivation due to improper storage. Sigma 70 Master Mix must be stored at -80 °C and number of freeze-thaw cycles should be minimized.

Contamination of myTXTL® reaction with nuclease. To avoid nuclease contamination, wear gloves and use nuclease-free water, sterilized tips and tubes.

Please review the recommendations to set up a myTXTL® reaction in the kit manual (LINK).


Yes! Parameters that influence protein production efficiency are:

Gene cassette construction (promoter strength, position of affinity tag, TXTL elements)
Plasmid purity
Plasmid concentration
Incubation temperature and time
Presence of folding helpers, chaperones, oxidizing agents

and should therefore be evaluated for optimization. Please also see our recommendations on Template Design in the kit manual (LINK).


Consider if your recombinant protein requires co-factors like heavy metal ions or coenzymes to be functionally active. Those should be present during protein synthesis. Additionally, a low concentration of mild detergent (e.g. Triton-X-100, sodium dodecyl maltoside, or CHAPS) can be added to the reaction as well as molecular chaperones. Please note that the myTXTL® platform cannot introduce post-translational modifications like glycosylation or phosphorylation to your protein. Reducing the incubation temperature might help to prevent aggregation of the nascent polypeptide chain and to promote proper protein folding.

Unfortunately, not. However, studies have shown that supplementing cell-free systems with mixtures of reduced (GSH) and oxidized glutathione (GSSG), disulfide bond isomerase C (DsbC), protein disulfide isomerase (PDI) and/or chaperones (e.g. DnaK, DnaJ, GroEL, GroES) can promote the formation of disulfide bridges. In addition, pretreatment with iodoacetamide (IAM) to inactivate endogenous reductases which are present in the cell extract might also help (Review Article: Stech M & Kubick S, Antibodies 2015, 4, 12-33).

Batch-to-batch variation can be caused varying levels TXTL inhibitor contamination present in the plasmid solution. Please follow our recommendations on how prepare plasmid DNA as template for TXTL reactions which can be find in the kit manual (LINK).

Sample handling and storage is mainly determined by the stability of your molecule of interest (protein, DNA, RNA) and thus optimal conditions may need to be evaluated. But to ensure sample integrity, we would recommend to either process the myTXTL® reaction immediately after performing the incubation or store it at ≤ -20 °C.

Apart from standard biochemical methods like Coomassie-stained SDS-PAGE and western blot analysis, the great advantage of cell-free protein production is the open-system environment which allows the direct quantification and/or analysis of its functionality in an activity assay or the downstream processing via affinity purification (if an affinity tag is present). If you choose SDS-PAGE analysis, you can either take a small sample (1-3 µL) directly from your TXTL reaction, or – to reduce background signal – precipitate proteins with TCA/acetone or ammonium-acetate/methanol following a standard protocol.

Most importantly, the excitation and emission wavelength should match the fluorescence properties of deGFP/eGFP (e.g. λEm 488 nm, λEx 535 nm). Other reader settings such as reading mode, integration time and gain value should be chosen under consideration of high well-to-well fluorescence reading reproducibility.

 


No. All our Toolbox 2.0 plasmids (except the positive control plasmid P70a-deGFP that comes with the myTXTL® kit) are meant for plasmid amplification in E. coli only. The degree of purity is NOT sufficient for efficient in vitro production. Please refer to the current myTXTL® manual (LINK) for recommendations on preparation of plasmid templates for TXTL reactions.

Yes. For all plasmids containing the lambda phage promoter (P70a, P70b, P70c, P70d) it is extremely crucial to use E. coli KL740 as transformation strain. When cultivated below 30 °C, this strain over-expresses the lambda phage repressor protein Cl857, thus ensuring high transformation efficiency and plasmid stability. KL740 can be purchased from Coli Genetic Stock Center (Yale) [CGSC#: 4382]. For all other plasmids, a standard laboratory E. coli cloning strain like JM109 or DH5alpha is sufficient.

A standard protocol for chemical transformation usually produces E. coli cells with a sufficient competency for plasmid intake. We recommend following the procedure described in Sambrook et al. 1989.

Transformation efficiency extremely depends on the quality of the competent cells. Make sure that cells were immediately frozen after preparation and stored at ≤ 80 °C. Please also note that for some cells, transformation efficiency drops drastically over time. Additionally, we advise to use E. coli strain KL740 for amplification of any plasmids containing σ70-specific promoter like P70a.

All P70 promoters originate from the lambda phage promoter for the repressor Cro with its two operator sites and are specific to the E. coli sigma factor 70. They differ in strength (P70a > P70d > P70b > P70c) due to mutations that were introduced at -35 and/or -10 regions.

We do offer a comprehensive gene synthesis and cloning service (myDNA®) (LINK) that serves you with error-free DNA molecules at your convenience. Because we work with a modular part system, the cloning procedure will be straight forward with almost no limitations in combinatorial combinations at a very competitive pricing.

Yes. Please note, that every gene circuit should start with a σ70-specific promoter like P70a.
WE'RE HERE TO HELP
If you need assistance placing an order, requesting a quote, or technical support, feel free to contact our team directly.